Skip to main content

Advertisement

Table 1 Primers used in RT-qPCR analysis of salt and drought response genes

From: Genome-wide identification of OSCA gene family and their potential function in the regulation of dehydration and salt stress in Gossypium hirsutum

Gene name Forward primer(5′-3′) Reverse primer(5′-3′)
GhOSCA1.1 CGAAACGCCAATCTCGAAGG AGCCTCCGGTAAGGATTGTG
GhOSCA3.1 CTTTGCCTTGGGTTGGCTTG ACAATATCGGGAGCGGAACC
GhOSCA1.16 CCCTGGCAGTGTGGACTATC CAGCACCACTCTCGTACTGG
GhOSCA3.3 CACACGGCTCTTGAAGTTGC TCTCAGGAATCAAGCTCGGC
GhOSCA1.3 ACACAACAATCCCGAGACCC AAGGAATCGGTAGGTTCGGC
GhOSCA1.2 CGAAACGCCAATCTCGAAGG AGCCTCCGGTAAGGATTGTG
GhOSCA2.5 GCGGAAAGTGTTGAGTGCAA AAAGCAGCTGGACGTTCCTT
GhOSCA2.12 GCTCAAACTCAGCAGCACAC TCCCTTGAACAGCAGTGACG
GhOSCA3.2 AAGAGTCCAAGGTTGTGGGC CTGAAGTGGCATTCGGCAAG
GhOSCA3.4 CTCCGGAATCAGGCACTCAA TGGTATAACAGCAGGGCACC
GhOSCA1.4 CTTGGCCTCGTTTATGCTGC TGACGGAAGACGACGTAAGC