Skip to main content

Table 2 The primers used in PCR analysis

From: Overexpressing rice lesion simulating disease 1-like gene (OsLOL1) in Gossypium hirsutum promotes somatic embryogenesis and plant regeneration

Gene Forward primer Reverse primer
OsLOL1 atgccggttccccttgctcc tcagctgctgggcttctggtc
npt II gagccatatcaacgggaaac gaaaaactcatcgagcatcaaatg
GhSOD1 cctcacttca atcctgctgg gagaggaatctgtttgtcgac
GhAmy7 ctatgatcactttgttgattg ctcatcaattgcggcaacatac
GhAmy8 gcttatattctaacccatcc agcccgaatagtaactgtgcttg
GhUbi cccctgggctggtaagatac ggtgccattactatcgctactg