Skip to main content

Advertisement

Table 1 List of polymorphic molecular markers for mapping of the recessive v1 gene

From: Map-based cloning of a recessive gene v1 for virescent leaf expression in cotton (Gossypium spp.)

Marker Product size /bp Forward primer (5′-3′) Reverse primer (5′-3′)
CIR094 80 ATACCTCCTTTGGCATC ATTCAGCAACTTCACACA
VS1 140 TCAATATTGGTGGGCTGAAA GCCCATAGATTTGCCTTCAA
VS2 223 ATCTCGGCGGCCTATTAGTT CCTAGGCTCCTCAGCTTCCT
VS3 193 CCTAATGTGGGTGGATTTGG TCAACTCAACCGGACACAAC
VS4 222 GATGACGATGACGATGATGG CGCTATTGAATGATGATGTGC
VS5 213 TCTTCATCAATTCTCCTCCTCC CGTTATCAGTGGGTTCGAATG
VS6 220 TGGGTTCTTGAATCGTGTCAT TACCCGAACCCTCCCATATT
VS7 174 CAGCGGTGGTGTAAAGATCA TGAAGCACAAATGCCTCATC
VS8 248 GAACCCAAGAGACAACGTATCA TTTGGAGGAAACAAGCCAAT
VS9 191 AAGAAATAGGCAGCGCAATG CACGACTGCCACTTGAGAAA
VS10 250 TCCTTATCCAACACTCACCAAG TGAGGCATGTCACTGATTCAA
VS11 242 TTAGAAGAATGGTTGAATTAAGCTC AAATAAACTTGATCTCCATGTAACAAA
VS12 230 TAATTTGCTCAAATGCGCTC ATTCTTTGGACTACAGCACCA
BNL2570 236 TTCTACAAAAAAAGAAAAAATGGG AAATACGGATGGGACCAACC
Muss143 173 AGATAAAGCTCCCACTTCCTCC CTTCAGGATCCTTCCAAGAGG
VS13 480 TGGCACAAGTGCTGACTGAT TCAGACTCGAACCCGGAAAC
VS14 183 TGTATTCAAATGCACAGTCCAA GGTTATGCTTGATGACATGGG
VS15 240 CCAAGTAATGGAGCACCAACT AACGCCCTAACGATTATGTCA
VS16 136 AAATAAATTCGGATTGACTCACTTT GCCGACAGAGTGTGGATCTT
VS17 417 CTGAGGTTGCACCGCATTTT TTTAGCGGATGAAGGCGTTG
VS18 318 GCCCACACATGCATTTCACT ACGGTAGGTCAACGAAGTAGC
VS19 493 TTGCTTGACTCAGCTCGACA TTGCATGAGCTGCACTACCA
VS20 425 CAAACCATCGCTGCAGTTCC ACTTTGCCAGCATGGGTACA
VS21 472 GCAATGCGATTTGGCTTCCT ATCCAAACGCCGCTAAAAGC