Skip to content

Advertisement

  • Research
  • Open Access

Map-based cloning of a recessive gene v1 for virescent leaf expression in cotton (Gossypium spp.)

Journal of Cotton Research20181:10

https://doi.org/10.1186/s42397-018-0009-7

  • Received: 7 June 2018
  • Accepted: 20 August 2018
  • Published:

Abstract

Background

Virescence, as a recognizable phenotype in the early development stage of cotton, is not only available for research on chloroplast development and photosynthesis but also for heterosis exploitation in cotton.

Methods

In current study, for fine mapping of virescent-1 (v1) in cotton, three populations with a total of 5 678 individuals were constructed using T582 which has the virescent trait. Tobacco rattle virus, TRV1 and TRV2 (pYL156), were used as vectors for the virus-induced gene silencing (VIGS) assay.

Results

The v1 gene was fine-mapped to a 20 kb interval on chromosome 20 of tetraploid cotton. We identified only one candidate gene with four single nucleotide polymorphisms between parents, among which the single nucleotide polymorphism at the position of 1 082 base pair caused the change of amino acid residue from Arg (3–79) to Lys (T582). The relative expression of the candidate gene in virescent plants was extensively lower than that in normal plants. Nullification of the gene by VIGS significantly turned the green leaf of normal cotton plants into yellow. We named this candidate gene as GhRVL.

Conclusions

This study will facilitate the further research on virescent formation, and will be useful for breeding of hybrid cottons.

Keywords

  • Cotton
  • Virescence
  • T582
  • VIGS

Background

The phenotype of the virescent mutant is characterized by yellowish leaves at the early stage, which gradually become normal green leaves at maturity. Virescent mutants have been found in an extensive list of plant species including cotton (Killough and Horlacher 1933), tomato (Richard and Charles 1954), cucumber (Aalders 1959), barley (Jain 1966), peanut (Benedict and Ketring 1972), soybean (Palmer and Mascia 1980), maize (Hopkins and Elfman 1984), tobacco (Archer and Bonnett 1987), rice (Iba et al. 1991), Arabidopsis (López-Juez et al. 1998), rape (Zhao et al. 2000) and sugi (Hirao et al. 2009). Many previous researches explored the mechanism of chloroplast development and photosynthesis in virescent mutants (Iba et al. 1991; López-Juez et al. 1998; Benedict and Kohel 1968; Fambrini et al. 2004; Wang et al. 2016a, 2016b), which helped to elucidate the mechanism of chlorophyll (Chl) synthesis and degradation, and to explore the interaction of genes in nucleus and chloroplast (Karaca et al. 2004; Sugimoto et al. 2004) for the complex expression patterns such as temperature-induced virescent mutant (Turcotte and Feaster 1978) and transient or long-lasting virescent mutant (Percival and Kohel 1974; Endrizzi et al. 1984). Further, many other studies on chlorophyll biosynthetic process in Arabidopsis and rice provided a critical understanding for virescent variations (Koncz et al. 1990; Falbel and Staehelin 1994; Nakayama et al. 1995; Kruse et al. 1997; Zhang et al. 2006).

The whole pathway of Chl biosynthesis is consisted of 27 genes that encode 15 enzymes from glutamyl-tRNA to Chl b in Arabidopsis (Zhu et al. 2014; Wang et al. 2016a, 2016b). In Chl biosynthesis, the initial step is the insertion of Mg2+ into protoporphyrin IX. Same as in Arabidopsis, the mutant cs directly involved in Chl biosynthesis by motivating the ATP-dependent binding of Mg2+ into protoporphyrin IX (Rissler et al. 2002; Ikegami et al. 2007), exhibiting the yellowish leaf phenotype (Koncz et al. 1990; Kobayashi et al. 2008). While in rice, an oxygenase mutant gene ygl1 (osCAO) led to yellow-green leaves and delayed chloroplast development at seedling stage (Wu et al. 2007). On the other hand, a negative correlation has been found between protoporphyrin and heme biosynthesis in tetrapyrrole biosynthesis, suggesting that excess of heme will cause inhibition of chlorophyll synthesis which resulted in leaf color mutant with lack of chlorophyll (Cao et al. 2009). For instance, elevated accumulation of the OsHO2 (Heme oxygenase) into Mg-protoporphyrin IX in rice caused the leaf color mutant (Li et al. 2014b).

The virescent trait with a photoperiod-sensitive genetic male sterility in cotton can reduce the cost of hybrid breeding and promote the exploitation of heterosis to overcome the limitations of seed production in the 3-line system (Zhao et al. 2000; Duncan and Pate 1967; Ma et al. 2013). To date, out of twenty virescent genes, seven single recessive nuclear genes from more than 30 mutants of the tetraploid cotton have been mapped in genetic linkage groups (Endrizzi et al. 1984). Previously, Killough and Horlache found that a virescent mutant plant in Mebane varieties of upland cotton controlled by a recessive single nucleus gene v1 which has been transferred into T582 (Kohel et al. 1965) and mapped into XVII linkage goup (Kohel 1983). Subsequent genetic mapping of F2 population (T582 × Hai7124) showed that the v1 gene resided on chromosome 20 of D subgenome with the closest genetic distance of 10.3 cM to CIR094 (Hu and Zhou 2006). Therefore, current study was conducted to clone the v1 gene with molecular markers which developed from the cotton genome sequence using map-based techniques (Wang et al. 2012; Li et al. 2014a; Li et al. 2015; Lu et al. 2015).

Methods

Plant materials and phenotypic data collection

T582 is a multi-recessive marker stocking with cu, fg, cl1, gl1, and v1 genes, while 3–79 and Pima 90 are sea island cottons with non-virescent trait. Chi-square tests were performed on three populations, including (i) population I of T582 × (T582 × 3–79) BC1F1, (ii) population II consisting of (3–79 × T582) × T582 BC1F1, and (iii) population III having BC1F1 of (Pima 90 × T582) × T582. A total of 1 200 plants from the population I, 2 193 plants from the population II, and 2 285 plants from the population III were screened for virescent to non-virescent ratio of 1:1, respectively.

DNA extraction and polymerase chain reaction (PCR) analysis

The genomic DNA of fresh leaf tissues from all populations and their parents was extracted following cetyl trimethyl ammonium bromide (CTAB) method (Paterson et al. 1993). PCR was conducted with a total volume of 10 μL consisting of 1 μL 10 × PCR buffer (TransGen Biotech Co., Ltd., Beijing), 0.5 μL 2.5 mmol·L− 1 dNTPs (TransGen Biotech Co., Ltd., Beijing), 0.2 μL each 10 μmol·L− 1 primer (GenScript Co.,Ltd., Nanjing), 30 ng template DNA and 0.1 μL 5 U·μL− 1 Taq DNA polymerase (TransGen Biotech Co., Ltd., Beijing). The PCR amplification was conducted as follows: 3 min at 94 °C; followed by 27 cycles of 30 s at 94 °C, 30 s at 55 °C, and 1 min at 72 °C. The final extension was done at 72 °C for 5 min. The amplified PCR products were then separated by the 8.0% polyacrylamide gels.

Development of molecular markers for fine mapping

Based on the closest marker (CIR094) to v1 (Hu and Zhou 2006), we used the SciRoKo34 software to get further SSR(Simple sequence repeats) primers (Kofler et al. 2007). When no polymorphic SSR was found in a fine mapping interval, we explored arbitrary sequence from every 500 base pairs (bp) of the interval through the Primer 5.0 software. To analyze the polymorphism and linkage map of all markers, we used parental plants and six of each virescent and non-virescent individuals from the population I.

Fine mapping of the v 1 gene

We used 1 200 plants (581 virescent and 619 non-virescent) of the population I for the initial mapping by SSR markers. Joinmap 3.0 software was used to analyze linkage between v1 gene and molecular markers (Van Ooijen and Voorrips 2001). Subsequently, we also used 1 095 virescent plants and 1 098 non-virescent plants from the population II and 1 106 virescent plants and 1 179 non-virescent plants from the population III for the fine mapping of v1.

Identification and sequence analysis of the v 1 candidate genes

We obtained the sequence of the predicted gene from the Cotton Genome Project database (http://cgp.genomics.org.cn/page/species/index.jsp) and the G. hirsutum genome database (http://mascotton.njau.edu.cn/info/1054/1118.htm), and further confirmed by BLAST(Basic local alignment search tool) searches using the EST(Expressed sequence tag) database. The full-length v1 candidate gene in virescent and non-virescent plants was amplified by the 5′-ATGGCTTCCGTGCTTGGAACCTCAA-3′, 5′-TCAGCTGAAAACCTCATAGAATTTC-3′ primer pair. PCR assays were conducted to amplify the region which was subsequently cloned by One Step Cloning Kit (Vazyme, Nanjing) into PBI121 vector (TaKaRa, Dalian), and sequenced by the Genewiz (Beijing, China). Sequence alignments were performed with NCBI-BLAST and sequences were analyzed using ClustalW2 (https://www.ebi.ac.uk/Tools/msa/clustalw2/).

Quantitative reverse transcription-PCR (qRT-PCR) analysis

Total RNA was isolated using EASY spin Plant RNA Kit (Aidlab, Beijing) from fresh leaves of the 3–79 and T582, respectively. Afterwards, PrimeScript™ II 1st strand cDNA Synthesis Kit (TaKaRa, Dalian) was used to synthesize the first-strand cDNA. qRT-PCR was carried out in a total volume of 20 μL containing 10 μL SYBR® Premix Ex Taq II (2×), 2 μL cDNA, 0.4 μL ROX Reference Dye II (50×), 0.8 μL of 10 μmol·L− 1 forward and reverse primers each and 6 μL ddH2O. PCR was conducted in ABI PRISM@7500-Fast Real-Time PCR system under the following conditions: 30 s at 95 °C; 40 cycles of 5 s at 95 °C and 30 s at 60 °C; followed by 15 s at 95 °C, 1 min at 60 °C, 15 s at 95 °C (Cheng et al. 2016). qRT-PCR was carried out by the gene-specific primers (5′-ATTGCCACTGTCATCCCCAACTGCT-3′, 5′-TCAGCTGAAAACCTCATAGAATTTC-3′) and actin (Genbank ID: AY305733) (5′-ATCCTCCGTCTTGACCTTG-3′, 5′-TGTCCGTCAGGCAACTCAT-3′) was employed as an internal control. Last, relative gene expression was quantified using the 2–ΔΔCTmethod.

VIGS (virus-induced gene silencing) assay

Tobacco rattle virus, TRV1 and TRV2 (pYL156), were used as vectors for the VIGS (Virus-induced gene silencing) assay. The cotton phytoene desaturase (PDS) was used to check the efficiency of VIGS (Tuttle et al. 2008; Pang et al. 2013), since the silencing of PDS gene caused the loss of carotenoids and chlorophyll which resulting in white leaves. The pYL156 was employed as the negative control. A 250 bp fragment of the GhRVL gene was amplified from cDNA library of CCRI (China Cotton Research Institute, former name of ICR, CAAS) 12-Dgl leaf tissues by PCR using the primer pair 5′-CTCACATCCTGCTCGGTTTATTCTC-3′, 5′-AGAAGAAAGAGAACTCCTAGCTGAA-3′, and inserted into the vector pYL156 by BamHI and KpnI double digestion to construct pYL156-RVL. Four vectors were transformed into GV3101 strain of Agrobacterium tumefaciens by freeze-thaw method. The Agrobacterium cultures were grown overnight in LB medium having 25 μg·mL− 1 rifampicin, 50 μg·mL− 1 kanamycin and gentamycin at 28 °C. The bacteria were harvested at 4 000 r·min− 1 for 5 min and re-suspended in infiltration solution (LB medium having 10 mmol·L− 1 MgCl2, 10 mmol·L− 1 MES and 200 μmol·L− 1 acetosyringone). The three different bacterial cultures of pYL156-RVL, pYL156-PDS and pYL156, respectively, mixed with pTRV1 at 1:1 ratio after staying at 25 °C for 4 h. The seedling stage of CCRI 12-Dgl was used for VIGS and the procedures for the infiltration infection were carried out according to the previous description (Gao and Shan 2013). The phenotype of the infiltrated plants was examined 1 week later. Total RNA was isolated from the true leaves of silenced and controlled plants, respectively. qRT-PCR was performed to confirm the silencing of the GhRVL gene in the VIGS plants.

Results

Genetic analysis of virescent traits

The leaves of T582 are virescent at early stage (Fig. 1a), while 3–79 and Pima 90 have green leaves during the entire growth season (Fig. 1b). Among three backcross populations constructing for the fine mapping of the v1 gene, 581 virescent plants and 619 non-virescent plants derived from the population I (T582 × (T582 × 3–79) BC1F1) fit at 1:1 ratio (χ2 = 1.2033, P > 0.05). Similarly, 1:1 ratio (χ2 = 0.0041, P > 0.05) has been found between the 1 095 virescent plants and 1 098 non-virescent plants of population II (BC1F1 segregating plants of (3–79 × T582) × T582). And, the ratio of 1 106 virescent plants to 1 179 non-virescent plants from population III which derived from the BC1F1 of (Pima90 × T582) × T582 was 1:1 (χ2 = 2.3322, P > 0.05). These results showed that a recessive nuclear gene v1 controlled the virescent phenotype in T582, which is also consistent with previous studies (Killough and Horlacher 1933; Kohel et al. 1965).
Fig. 1
Fig. 1

Comparison of the virescent and non-virescent leaves. a Virescent leaf. b Non-virescent leaf

Primary mapping of the v 1 gene

Previous study showed that CIR094 was identified near the v1 gene with 10.3 cM distance on chromosome 20 of tetraploid cotton (Hu and Zhou 2006). A linkage marker Dt_chr11–5923 (VS12) was obtained by genome-wide molecular markers (Lu et al. 2015) which is closer to the v1 gene than BNL2570 and MUSS143 analyzed by 1 200 individuals of population I. There was approximately 5 Mb distance between CIR094 and VS12 markers, which was confirmed by BLAST search in the whole genome sequence of G. hirsutum and G. raimondii (Wang et al. 2012; Li et al. 2015). Fifteen primer pairs of polymorphic SSR markers which designed by the SciRoKo 34 software were screened to the 5 Mb intervals from G. hirsutum genome database. With the linkage analysis by JoinMap 3.0, v1 was initially mapped to a 275 kb region between VS2 and VS3 (Fig. 2a), which was further lessened to a 100 kb region between VS13 and VS14 (Fig. 2b) with the assistance of virescent and non-virescent plants of the population I.
Fig. 2
Fig. 2

Genetic and physical maps of the v1 gene and sequence analysis of the candidate gene on chromosome 20 of the D subgenome in cotton. a Linkage map of the scaffold assembled using 1 200 selected individuals from population I. v1 was mapped between VS2 and VS3 markers at around 275 kb. b Additional mapping of v1. v1 was further mapped to a 100 kb interval by VS13 and VS14 with the recombinants in population II. c Candidate region for v1 and predicted gene. Candidate region for v1 was identified between VS18 and VS19 at about 20 kb. One gene was found in that region. Numbers of recombinants between v1 and markers were presented under the linkage map. d Sequence comparisons of the candidate gene in 3–79 and T582. SNPs at the sequence positions of 426, 450, 709 and 1 082 were shared by 3–79 and T582

Fine mapping of the v 1 gene

As no polymorphic SSR is available for the 100 kb interval, the polymorphism of 96 SSR markers from every 500 bp of the 100 kb interval was screened by T582 and 3–79, and obtained five polymorphic arbitrary markers named VS17, VS18, VS19, VS20, and VS21. Then, 1 095 virescent plants and 1 098 non-virescent plants from the population II were used to further refine the range of the v1 gene, which mapped it approximately 20 kb interval between VS18 and VS19 (Fig. 2c). Meantime, five polymorphic arbitrary markers were verified between the virescent and non-virescent plants of population III, which were consistent with the fine mapping results of population II (Fig. 2c). As no polymorphic SSR and recombinant individuals were found in all three mapping populations, it was concluded that v1 gene was located in the 20 kb interval between VS18 and VS19. Information about all markers was listed in Table 1.
Table 1

List of polymorphic molecular markers for mapping of the recessive v1 gene

Marker

Product size /bp

Forward primer (5′-3′)

Reverse primer (5′-3′)

CIR094

80

ATACCTCCTTTGGCATC

ATTCAGCAACTTCACACA

VS1

140

TCAATATTGGTGGGCTGAAA

GCCCATAGATTTGCCTTCAA

VS2

223

ATCTCGGCGGCCTATTAGTT

CCTAGGCTCCTCAGCTTCCT

VS3

193

CCTAATGTGGGTGGATTTGG

TCAACTCAACCGGACACAAC

VS4

222

GATGACGATGACGATGATGG

CGCTATTGAATGATGATGTGC

VS5

213

TCTTCATCAATTCTCCTCCTCC

CGTTATCAGTGGGTTCGAATG

VS6

220

TGGGTTCTTGAATCGTGTCAT

TACCCGAACCCTCCCATATT

VS7

174

CAGCGGTGGTGTAAAGATCA

TGAAGCACAAATGCCTCATC

VS8

248

GAACCCAAGAGACAACGTATCA

TTTGGAGGAAACAAGCCAAT

VS9

191

AAGAAATAGGCAGCGCAATG

CACGACTGCCACTTGAGAAA

VS10

250

TCCTTATCCAACACTCACCAAG

TGAGGCATGTCACTGATTCAA

VS11

242

TTAGAAGAATGGTTGAATTAAGCTC

AAATAAACTTGATCTCCATGTAACAAA

VS12

230

TAATTTGCTCAAATGCGCTC

ATTCTTTGGACTACAGCACCA

BNL2570

236

TTCTACAAAAAAAGAAAAAATGGG

AAATACGGATGGGACCAACC

Muss143

173

AGATAAAGCTCCCACTTCCTCC

CTTCAGGATCCTTCCAAGAGG

VS13

480

TGGCACAAGTGCTGACTGAT

TCAGACTCGAACCCGGAAAC

VS14

183

TGTATTCAAATGCACAGTCCAA

GGTTATGCTTGATGACATGGG

VS15

240

CCAAGTAATGGAGCACCAACT

AACGCCCTAACGATTATGTCA

VS16

136

AAATAAATTCGGATTGACTCACTTT

GCCGACAGAGTGTGGATCTT

VS17

417

CTGAGGTTGCACCGCATTTT

TTTAGCGGATGAAGGCGTTG

VS18

318

GCCCACACATGCATTTCACT

ACGGTAGGTCAACGAAGTAGC

VS19

493

TTGCTTGACTCAGCTCGACA

TTGCATGAGCTGCACTACCA

VS20

425

CAAACCATCGCTGCAGTTCC

ACTTTGCCAGCATGGGTACA

VS21

472

GCAATGCGATTTGGCTTCCT

ATCCAAACGCCGCTAAAAGC

Identification and sequence analysis of the v 1 candidate gene

One candidate gene Gh_D10G0283 which was identified in the 20 kb mapping interval based on genome annotation databases (http://cgp.genomics.org.cn/page/species/index.jsp and http://mascotton.njau.edu.cn//info/1054/1118.htm) and BLAST search result with EST and Unigene databases in NCBI. The length of open reading frame (ORF) was 1 269 bp encoding 422 amino acids (Fig. 3). The candidate gene was homologous to the magnesium chelatase I gene (ChlI, AAM98163) of Arabidopsis, which derived the ATP-dependent insertion of Mg2+ into protoporphyrin IX with yellowish leaf phenotype (Rissler et al. 2002; Ikegami et al. 2007). Sequence alignment between 3-79 and T582 showed 4 single nucleotide polymorphisms (SNPs) differences at 426, 450, 709, and 1 082 positions, respectively (Fig. 2d). According to protein sequence alignment, the SNP at position of 1 082 caused amino acid residue mutant from Arg (3–79) to Lys (T582), while the other SNPs had synonymous substitution. Furthermore, qRT-PCR showed that the relative expression of the candidate gene in T582 was significant lower than that of 3–79 (Fig. 4a), suggesting that the candidate gene may cause the formation of virescent leaf.
Fig. 3
Fig. 3

The sequence of the v1 candidate gene

Fig. 4
Fig. 4

Results of qRT-PCR. a Expression analysis of the candidate gene in 3–79 and T582, respectively. Y-axes indicates the relative expression level of the gene and X-axes represents the candidate gene in the 3–79 and T582, respectively. b: The results of the pYL156 and VIGS-RVL in CCRI 12-Dgl, respectively. Y-axes indicates the relative expression level of the gene and X-axes represents the pYL156 and VIGS-RVL in the CCRI 12-Dgl, respectively

Silencing of the v 1 candidate gene leading to yellow leaf

Functional analysis of the v1 gene was performed in CCRI 12-Dgl (Cheng et al. 2016) using VIGS to validate its role in the formation of virescent leaf in cotton. The 250 bp interference fragment was inserted into a TRV2 (tobacco rattle virus) vector to construct the VIGS vector. One week after the Agrobacterium-mediated infection, the mutant phenotypes of the VIGS-treated plants started to emerge. The plants injected with pYL156-PDS revealed a photo-bleaching of leaves (Fig. 5c), while yellow-green leaves of the plants infiltrated with pYL156-RVL were observed (Fig. 5b). Meanwhile, the plants infiltrated with pYL156 had no effect on non-virescent leaf (Fig. 5a). To check the silencing efficiency, RNA was extracted from leaves of VIGS plants for qRT-PCR. Expression of the candidate gene in the plants infected by pYL156-RVL which was reduced largely as comparing with the plants infected by pYL156 (Fig. 4b). Therefore, we concluded that silencing of the candidate v1 gene caused yellow leaves, and the candidate gene was subsequently named as GhRVL (Gossypium hirsutum regulator of virescent leaf) gene.
Fig. 5
Fig. 5

Silencing of the v1 candidate gene by VIGS resulted in CCRI 12-Dgl. pYL156 and pYL156-PDS were used as negative and positive controls, respectively. Leaves of VIGS plants displayed mutant phenotype. a Normal green phenotype in negative control plant; b yellowish phenotype in the plant infected by pYL156-RVL; c Photo-bleaching phenotype in positive control plant

Discussion

T582 serves as a basic tool for scientific study into the mechanism of cotton metabolism, inheritance and development due to its multiple recessive marker stocking with cu, fg, cl1, gl1, and v1 (Kohel et al. 1965). The candidate gene of the pigment glands which related gene gl1 would provide the prospects of fabricating gossypol-free cotton seeds (Cheng et al. 2016). In addition, many important genes were subdivided into different linkage groups through T582 (Percival and Kohel 1974; Endrizzi et al. 1984). Especially, seven of the 20 virescent genes were reported at one recessive locus in the tetraploid cotton species, which further have been mapped by linkage analysis (Duncan and Pate 1967; Endrizzi et al. 1984). Genes v1 and v7 were found to be homoeoallelic, which are functionally similar and located on homoeologous chromosomes (Turcotte and Feaste 1973). Therefore, cloning of gene v1 is helpful to clone the other gene v7 and to analyze their interaction in cotton.

Previous study reported that gene v1 was located in the interval between CIR094 and BNL2570 markers on chromosome 20 of the D sub-genome (Hu and Zhou 2006). In this study, we took advantage of the databases of cotton genome and genome-wide molecular markers (Wang et al. 2012; Li et al. 2014a, ; Li et al. 2015; Lu et al. 2015) to develop new SSR markers and arbitrary sequences for fine mapping of the v1 gene. The polymorphism and recombination events were detected in three populations, which identified one candidate gene in a 20 kb interval between VS18 and VS19 markers. Results showed that v1 is a single recessive gene in cotton which is homologous to the magnesium chelatase I (ChlI) gene, contains a P-loop NTPase domain and is a member of the AAA+ protein family (Fodje et al. 2001; Iyer et al. 2004). It plays an important role in chlorophyll biosynthesis by motivating the inclusion of Mg2+ into protoporphyrin IX. Chlorina mutant aci5–3 in Arabidopsis and one semi-dominant Oil yellow 1 (Oy1) mutants in maize are caused by missense mutations in the highly conserved AAA+ domain of ChlI subunits (Soldatova et al. 2005; Sawers et al. 2006). However, CHLI is encoded by two genes in Arabidopsis compared with a single copy gene of barley and tobacco, which shows 82% similarity between CHLI1 and CHLI2 (Kobayashi et al. 2008). The expression level of CHLI2 which contributes to the assembly of the Mg-chelatase complex is much lower than that of CHLI1 (Kobayashi et al. 2008). But, a transgene of CHLI2 motivated by the promoter of CHLI1 can be functionally equivalent to CHLI1 (Huang and Li 2009). In transgenic tobacco, either a decreased or increased expression of the CHLI subunit would diminish Mg chelatase activity and significantly reduce chlorophyll content (Papenbrock et al. 2000). In current study, the candidate gene GhRVL was homologous to the magnesium chelatase I gene (ChlI, AAM98163) in Arabidopsis. The candidate gene GhRVL just has single base change at 1 082 bp position which caused the change of the 361st amino acid residue from Arg (3–79) to Lys (T582). And the results of qRT-PCR showed that the relative expression level of GhRVL in virescent plants was much lower than that in non-virescent plants. We hypothesized that the different phenotype of the virescent-1 mutant in T582 compared with normal plant in 3–79 is probably due to the promoter difference between them (Zhu et al. 2017; Mao et al. 2018).

Virescent character is a useful morphological indicator which is controlled by recessive genes (Benedict et al. 1972). However, more than 30 virescent mutants were not found their target genes in cotton (Song et al. 2012). The virescent gene v1 can serve as a valuable resource for heterosis utilization (Duncan and Pate 1967; Ma et al. 2013), for exploring the mechanism of photosynthesis as well as for a better understanding of genetic interactions.

Conclusions

This report reveals fine mapping and cloning of the candidate gene GhRVL of virescence in cotton which significantly turned the green leaf color of normal cotton plants into yellow by VIGS.

Declarations

Acknowledgments

We thank State Key Laboratory of Cotton Biology, Institute of Cotton Research of Chinese Academy of Agricultural Sciences in China.

Funding

The National Key Research and Development Program of China (2016YFD0101401).

Availability of data and materials

Data sharing not applicable to this article as no datasets were generated or analyzed during the current study.

Authors’ contributions

Song GL managed the project and designed the research. Zhang YP, Wang QL, Zuo DY, Cheng HL, Liu K, Ashraf J, Li SM, Feng XX, and Yu JZ performed the experiments and prepared figures and tables. Zhang YP, Song GL and Wang QL wrote and revised the paper. All authors reviewed the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
State Key Laboratory of Cotton Biology, Institute of Cotton Research of Chinese Academy of Agricultural Sciences, Anyang, 455000, China
(2)
U. S. Department of Agriculture - Agricultural Research Service (USDA-ARS), Southern Plains Agricultural Research Center, College Station, TX 77845, USA

References

  1. Aalders LE. ‘Yellow cotyledon’, a new cucumber mutation. Can J Genet Cytol. 1959;1(1):10–2.View ArticleGoogle Scholar
  2. Archer EK, Bonnett HT. Characterization of a virescent chloroplast mutant of tobacco. Plant Physiol. 1987;83(4):920–5.View ArticlePubMedPubMed CentralGoogle Scholar
  3. Benedict CR, Ketring DL. Nuclear gene affecting greening in virescent peanut leaves. Plant Physiol. 1972;49(6):972–6.View ArticlePubMedPubMed CentralGoogle Scholar
  4. Benedict CR, Kohel RJ. Characteristics of a virescent cotton mutant. Plant Physiol. 1968;43(10):1611–6.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Benedict CR, Mccree KJ, Kohel RJ. High photosynthetic rate of a chlorophyll mutant of cotton. Plant Physiol. 1972;49(6):968–71.View ArticlePubMedPubMed CentralGoogle Scholar
  6. Cao YY, Duan H, Yang LN, et al. Effect of high temperature during heading and early grain filling on grain yield of indica rice cultivars differing in heat-tolerance and its physiological mechanism. Acta Agron Sin. 2009;35(3):512–21.Google Scholar
  7. Cheng HL, Lu CR, John ZY, et al. Fine mapping and candidate gene analysis of the dominant glandless gene Gl2e in cotton (Gossypium spp.). Theor Appl Genet. 2016;129(7):1347–55.View ArticlePubMedGoogle Scholar
  8. Duncan EN, Pate JB. Inheritance and use of golden crown virescence in cotton: and its relationship to other virescent stocks. J Hered. 1967;58(5):237–9.View ArticleGoogle Scholar
  9. Endrizzi JE, Turcotte EL, Kohel RJ. Qualitative genetics, cytology, and cytogenetics. Cotton. 1984;4:81–129.Google Scholar
  10. Falbel TG, Staehelin LA. Characterization of a family of chlorophyll-deficient wheat (Triticum) and barley (Hordeum vulgare) mutants with defects in the magnesium-insertion step of chlorophyll biosynthesis. Plant Physiol. 1994;104(2):639–48.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Fambrini M, Castagna A, Vecchia DF, et al. Characterization of a pigment-deficient mutant of sunflower (Helianthus annuus L.) with abnormal chloroplast biogenesis, reduced PSII activity and low endogenous level of abscisic acid. Plant Sci. 2004;167(1):79–89.View ArticleGoogle Scholar
  12. Fodje MN, Hansson A, Hansson M, et al. Interplay between an AAA module and an integrin I domain may regulate the function of magnesium chelatase1. J Mol Biol. 2001;311(1):111–22.View ArticlePubMedGoogle Scholar
  13. Gao X, Shan L. Functional genomic analysis of cotton genes with agrobacterium-mediated virus-induced gene silencing. Methods Mol Biol. 2013;975:157–65.View ArticlePubMedPubMed CentralGoogle Scholar
  14. Hirao T, Watanabe A, Kurita M, et al. A frameshift mutation of the chloroplast matK coding region is associated with chlorophyll deficiency in the Cryptomeria japonica virescent mutant Wogon-Sugi. Curr Genet. 2009;55(3):311–21.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Hopkins WG, Elfman B. Temperature-induced chloroplast ribosome deficiency in virescent maize. J Hered. 1984;75(3):207–11.View ArticleGoogle Scholar
  16. Hu FP, Zhou ZH. Molecuar marker and genetic mapping of five mutant genes in upland cotton. Molecular Plant Breeding. 2006;4:680–4.Google Scholar
  17. Huang YS, Li HM. Arabidopsis CHLI2 can substitute for CHLI1. Plant Physiol. 2009;150(2):636–45.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Iba K, Takamiya K, Toh Y, et al. Formation of functionally active chloroplasts is determined at a limited stage of leaf development in virescent mutants of rice. Dev Genet. 1991;12(5):342–8.View ArticleGoogle Scholar
  19. Ikegami A, Yoshimura N, Motohashi K, et al. The CHLI1 subunit of Arabidopsis thaliana magnesium chelatase is a target protein of the chloroplast thioredoxin. J Biol Chem. 2007;282(27):19282–91.Google Scholar
  20. Iyer LM, Leipe DD, Koonin EV, et al. Evolutionary history and higher order classification of AAA+ ATPases. J Struct Biol. 2004;146(1/2):11–31.Google Scholar
  21. Jain ML. Biochemical definition of yellow-virescent and light-green suppressor mutations in barley. Genetics. 1966;54(3):813–8.PubMedPubMed CentralGoogle Scholar
  22. Karaca M, Saha S, Callahan FE, et al. Molecular and cytological characterization of a cytoplasmic-specific mutant in pima cotton (Gossypium barbadense L.). Euphytica. 2004;139(3):187–97.View ArticleGoogle Scholar
  23. Killough DT, Horlacher WR. The inheritance of virescent yellow and red plant characters in cotton. Genetics. 1933;18(4):329–34.PubMedPubMed CentralGoogle Scholar
  24. Kobayashi K, Mochizuki N, Yoshimura N, et al. Functional analysis of Arabidopsis thaliana isoforms of the mg-chelatase CHLI subunit. Photochem Photobiol Sci. 2008;7(10):1188–95.Google Scholar
  25. Kofler R, Schlötterer C, Lelley T. SciRoKo: a new tool for whole genome microsatellite search and investigation. Bioinformatics. 2007;23(13):1683–5.View ArticlePubMedGoogle Scholar
  26. Kohel RJ. Genetic analyses of the yellow-veins mutant in cotton. Crop Sci. 1983;23(2):291–3.View ArticleGoogle Scholar
  27. Kohel RJ, Lewis CF, Richmond TR. Linkage tests in upland cotton, Gossypium hirsutum L. Crop Sci. 1965;5(6):582–5.Google Scholar
  28. Koncz CS, Mayerhofer R, Koncz KZ, et al. Isolation of a gene encoding a novel chloroplast protein by T-DNA tagging in Arabidopsis thaliana. EMBO J. 1990;9(5):1337–46.Google Scholar
  29. Kruse EL, Mock HP, Grimm B. Isolation and characterisation of tobacco (Nicotiana tabacum) cDNA clones encoding proteins involved in magnesium chelation into protoporphyrin IX. Plant Mol Biol. 1997;35(6):1053–6.View ArticlePubMedGoogle Scholar
  30. Li FG, Fan GY, Wang KB, et al. Genome sequence of the cultivated cotton Gossypium arboreum. Nat Genet. 2014a;46(6):567–72.View ArticlePubMedGoogle Scholar
  31. Li QZ, Zhu FY, Gao XL, et al. Young leaf chlorosis 2 encodes the stroma-localized heme oxygenase 2 which is required for normal tetrapyrrole biosynthesis in rice. Planta. 2014b;240(4):701–12.View ArticlePubMedGoogle Scholar
  32. Li FG, Fan GY, Lu CR, et al. Genome sequence of cultivated upland cotton (Gossypium hirsutum TM-1) provides insights into genome evolution. Nat Biotechnol. 2015;33(5):524–30.View ArticlePubMedGoogle Scholar
  33. López-Juez E, Jarvis RP, Takeuchi A, et al. New Arabidopsis cue mutants suggest a close connection between plastid and phytochrome regulation of nuclear gene expression. Plant Physiol. 1998;118(3):803–15.Google Scholar
  34. Lu CR, Zou CS, Zhang YP, et al. Development of chromosome-specific markers with high polymorphism for allotetraploid cotton based on genome-wide characterization of simple sequence repeats in diploid cottons (Gossypium arboreum L. and Gossypium raimondii Ulbrich). BMC Genomics. 2015;16(1):55.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Ma JH, Wei HL, Liu J, et al. Selection and characterization of a novel photoperiod-sensitive male sterile line in upland cotton. J Integr Plant Biol. 2013;55(7):608–18.View ArticlePubMedGoogle Scholar
  36. Mao GZ, Ma Q, Wei HL, et al. Fine mapping and candidate gene analysis of the virescent gene v 1 in upland cotton (Gossypium hirsutum). Mol Gen Genomics. 2018;293(1):249–64.Google Scholar
  37. Nakayama M, Masuda T, Sato N, et al. Cloning, subcellular localization and expression of CHLI, a subunit of magnesiumchelatase in soybean. Biochem Biophys Res Commun. 1995;215(1):422–8.View ArticlePubMedGoogle Scholar
  38. Palmer RG, Mascia PN. Genetics and ultrastructure of a cytoplasmically inherited yellow mutant in soybeans. Genetics. 1980;95(4):985–1000.PubMedPubMed CentralGoogle Scholar
  39. Pang JH, Zhu Y, Li Q, et al. Development of agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense. PLoS One. 2013;8(9):e73211.View ArticlePubMedPubMed CentralGoogle Scholar
  40. Papenbrock J, Pfündel E, Mock HP, et al. Decreased and increased expression of the subunit CHL I diminishes mg chelatase activity and reduces chlorophyll synthesis in transgenic tobacco plant. Plant J. 2000;22(2):155–64.View ArticlePubMedGoogle Scholar
  41. Paterson AH, Brubaker CL, Wendel JF. A rapid method for extraction of cotton (Gossypium spp.) genomic DNA suitable for RFLP or PCR analysis. Plant Mol Biol Report. 1993;11(2):122–7.View ArticleGoogle Scholar
  42. Percival AE, Kohel RJ. Genetic analysis of virescent mutants in cotton. Crop Sci. 1974;14(3):439–40.View ArticleGoogle Scholar
  43. Richard WR, Charles MR. New tomato seedling characters and their linkage relationships. J Hered. 1954;45(5):241–8.Google Scholar
  44. Rissler HM, Collakova E, DellaPenna D, et al. Chlorophyll biosynthesis. Expression of a second chl I gene of magnesium chelatase in Arabidopsis supports only limited chlorophyll synthesis. Plant Physiol. 2002;128(2):770–9.View ArticlePubMedPubMed CentralGoogle Scholar
  45. Sawers RJH, Viney J, Farmer PR, et al. The maize Oil yellow1 (Oy1) gene encodes the I subunit of magnesium chelatase. Plant Mol Biol. 2006;60(1):95–106.View ArticlePubMedGoogle Scholar
  46. Soldatova O, Apchelimov A, Radukina N, et al. An Arabidopsis mutant that is resistant to the protoporphyrinogen oxidase inhibitor acifluorfen shows regulatory changes in tetrapyrrole biosynthesis. Mol Gen Genomics. 2005;273(4):311–8.View ArticleGoogle Scholar
  47. Song MZ, Yang ZG, Fan SL, et al. Cytological and genetic analysis of a virescent mutant in upland cotton (Gossypium hirsutum L.). Euphytica. 2012;187(2):235–45.View ArticleGoogle Scholar
  48. Sugimoto H, Kusumi K, Tozawa Y, et al. The virescent-2 mutation inhibits translation of plastid transcripts for the plastid genetic system at an early stage of chloroplast differentiation. Plant Cell Physiol. 2004;45(8):985–96.View ArticlePubMedGoogle Scholar
  49. Turcotte EL, Feaste CV. The interaction of two genes for yellow foliage in cotton. J Hered. 1973;64(4):231–2.View ArticleGoogle Scholar
  50. Turcotte EL, Feaster CV. Inheritance of three genes for plant color in American pima cotton. Crop Sci. 1978;18(1):149–50.View ArticleGoogle Scholar
  51. Tuttle JR, Idris AM, Brown JK, et al. Geminivirus-mediated gene silencing from cotton leaf crumple virus is enhanced by low temperature in cotton. Plant Physiol. 2008;148(1):41–50.View ArticlePubMedPubMed CentralGoogle Scholar
  52. Van Ooijen JW, Voorrips RE. JoinMap® 3.0, software for the calculation of genetic linkage maps. Wageningen: Plant Research International. 2001. p. 1–51.Google Scholar
  53. Wang KB, Wang ZW, Li FG, et al. The draft genome of a diploid cotton Gossypium raimondii. Nat Genet. 2012;44(10):1098–103.View ArticlePubMedGoogle Scholar
  54. Wang YK, He YJ, Yang M, et al. Fine mapping of a dominant gene conferring chlorophyll-deficiency in Brassica napus. Sci Rep. 2016a;6:31419.View ArticlePubMedPubMed CentralGoogle Scholar
  55. Wang YL, Wang CM, Zheng M, et al. WHITE PANICLE1, a Val-tRNA synthetase regulating chloroplast ribosome biogenesis in rice, is essential for early chloroplast development. Plant Physiol. 2016b;170:2110–23.View ArticlePubMedPubMed CentralGoogle Scholar
  56. Wu ZM, Zhang X, He B, et al. A chlorophyll-deficient rice mutant with impaired chlorophyllide esterification in chlorophyll biosynthesis. Plant Physiol. 2007;145(1):29–40.View ArticlePubMedPubMed CentralGoogle Scholar
  57. Zhang HT, Li JJ, Yoo JH, et al. Rice Chlorina-1 and Chlorina-9 encode ChlD and ChlI subunits of mg-chelatase, a key enzyme for chlorophyll synthesis and chloroplast development. Plant Mol Biol. 2006;62(3):325–37.View ArticlePubMedGoogle Scholar
  58. Zhao Y, Wang ML, Zhang YZ, et al. A chlorophyll-reduced seeding mutant in oilseed rape, Brassica napus, for utilization in F1 hybrid production. Plant Breed. 2000;119(2):131–5.Google Scholar
  59. Zhu LX, Zeng XH, Chen YL, et al. Genetic characterisation and fine mapping of a chlorophyll-deficient mutant. Mol Breed. 2014;34(2):603–14.View ArticleGoogle Scholar
  60. Zhu JK, Chen JD, Gao FK, et al. Rapid mapping and cloning of the virescent-1 gene in cotton by bulked segregant analysis–next generation sequencing and virus-induced gene silencing strategies. J Exp Bot. 2017;68(15):4125–35.View ArticlePubMedPubMed CentralGoogle Scholar

Copyright

Advertisement