Skip to main content
Download PDF

Evaluation of Thellungiella halophila ST7 for improving salt tolerance in cotton

Journal of Cotton Research volume 5, Article number: 1 (2022) Cite this article

Abstract

Background

Gossypium hirsutum (upland cotton) is one of the principal fiber crops in the world. Cotton yield is highly affected by abiotic stresses, among which salt stress is considered as a major problem around the globe. Transgenic approach is efficient to improve cotton salt tolerance but depending on the availability of salt tolerance genes.

Results

In this study we evaluated salt tolerance candidate gene ST7 from Thellungiella halophila, encoding a homolog of Arabidopsis aluminum-induced protein, in cotton. Our results showed that ThST7 overexpression in cotton improved germination under NaCl stress as well as seedling growth. Our field trials also showed that ThST7 transgenic cotton lines produced higher yield under salt stress conditions. The improved salt tolerance of the transgenic cotton lines was partially contributed by enhanced antioxidation as shown by diaminobenzidine (DAB) and nitrotetrazolium blue chloride (NBT) staining. Moreover, transcriptomic analysis of ThST7 overexpression lines showed a significant upregulation of the genes involved in ion homeostasis and antioxidation, consistent with the salt tolerance phenotype of the transgenic cotton.

Conclusions

Our results demonstrate that ThST7 has the ability to improve salt tolerance in cotton. The ThST7 transgenic cotton may be used in cotton breeding for salt tolerance cultivars.

Background

Salinity stress is one of the most acute and critical abiotic stress that limits the growth and yield of crops (Tester and Davenport 2003; Parida et al. 2004). There is an immediate requirement to develop new varieties of salt tolerant crops that can cope with high salinity environments (Ma et al. 2020). To withstand the salt stress, plants have developed intricate mechanisms (Blumwald 2000). The higher concentration of sodium chloride in the environment disturbs the overall cellular homeostasis in plants (Zhu 2002). Plants have developed strategies to avoid the injuries from high NaCl levels (Flowers and Colmer 2008), for instance, sequestration of NaCl into large vacuole (Martinoia et al. 2007). Alteration of the ion transport mechanisms may also help plants in response against salt stress (Darko et al. 2020). The mechanisms of salt tolerance also include the acclimatization to the osmotic stress, cytoplasmic Na+ exclusion, Na+ and Cl− accumulation tolerance and compartmentalization, occurring in a disciplined manner (Munns and Tester 2008).

Cotton is considered as one of the principal fibers and oil seed crop. It is also used in medicinal products, household stuff, and as major raw material in textile industry. It fulfils 35% of world’s fiber need (Martinez et al. 2018). Abiotic stresses cause about 50% reduction of the global cotton yield. Salinity stress is among the most important restriction for cotton crop productivity and growth (Wang et al. 2003).

A number of studies have been done in order to develop salt tolerant cotton varieties via transgenic approach. For instance, TsVP, a H+-PPase gene from Thellungiella halophilla, was demonstrated to improve the growth of root and shoot and photosynthetic activity under high salinity in cotton (Lv et al. 2008). The transgenic plants showed decreased membrane ion leakage and malondialdehyde level as compared with the wild type because the transgene assisted the sequestration of Na+ and Cl− in the vacuoles (Lv et al. 2008). The expression of TsVP also enhanced the emergence and survival rate of cotton, improved fiber quality under high saline environment (Zhang et al. 2016a, b). Another study demonstrated that the expression of AVP1 encoding vacuolar pyrophosphatase from Arabidopsis thaliana improved growth of the transgenic cotton and the fiber yield under salt stress (Pasapula et al. 2011). Cheng et al. (2018) showed the co-expression of AtNHX1 gene from Arabidopsis thaliana and TsVP gene from Thellungiella halophilla in cotton enhanced emergence rate and yield of the transgenic cotton under high saline environment (Cheng et al. 2018).

Using a functional gene mining method, Du et al. (2008) identified SALT TOLERANCE (ST) genes from salt cress (ThST7). ThST7, one of the identified genes, encodes an auxin/aluminum-responsive protein (Du et al. 2008). The Arabidopsis homologue of ThST7gene is At5G19140 with 94% similarity to the ThST7 amino acid sequence (Du et al. 2008). A study conducted by Lin et al. showed that the transcript level of At5G19140 gene increased in hypoxia stress (Lin et al. 2017). This aluminum-induced protein was also found responsive to PEG stress in wheat (Pál et al. 2018). Putrescine treatment was found to upregulate the aluminum induced protein genes (Agarwal et al. 2009).

In this study, we aimed to evaluate the salt tolerance conferred by ThST7 gene we previously isolated from Thellungiella halophilla in cotton. Our results not only showed improved germination and growth performance of transgenic cotton lines under salt stress in controlled environment but also showed better performance in field trials.

Results

ThST7 enhanced cotton seed germination under salt stress

To evaluate ThST7-conferred salt tolerance in cotton, we made the overexpression construct and obtained transgenic lines by Agrobacterium-mediated transformation (Additional file 1: Fig. S1A). The expression of the transgene ThST7 was verified in the transgenic cotton lines by reverse transcription polymerase chain reaction (RT-PCR) analysis (Additional file 1: Fig. S1B). T3 transgenic cotton seeds were assessed for germination either with 250 mmol·L−1 or without NaCl stress. Both the control (CK) and transgenic (ST7-OE1 and ST7-OE2) cotton seeds were germinated at almost equal rate in absence of salt stress. Similarly, both CK and transgenic seeds attained stable germination rate at day 5–8 with initiation at the same time. While at 250 mmol·L−1 NaCl stress, germination rate of ST7-OE1 and ST7-OE2 transgenic cotton seeds was significantly higher (~ 37% and 33%, respectively) than CK seeds (~ 20%) on the 8th day of seed sowing. Transgenic seeds germinated 1 day earlier than the CK (Fig. 1A, B).

Fig. 1
figure 1

Expression of ThST7 gene in cotton confers salt tolerance phenotype in seed germination. A Seed germination curve. Seeds of the wild type (CK) and ST7-OE lines were germinated in soil watered with 0 or 250 mmol·L−1 NaCl for 8 days and germination percentage was recorded every day. Values are mean ± SD (10 seeds per replicate, five replicates per treatment). Different letters denote significant differences (P < 0.05) from Duncan's multiple range tests. B Seedling survival ratio. The above germinated seeds were grown for 2 weeks before seedling survival ratio was recorded. Values are mean ± SD (10 plants per replicate, five replicates per treatment). Different letters denote significant differences (P < 0.05) from Duncan's multiple range tests. C Growth of germinated seeds. Bar = 4 cm

Full size image

Under normal growth condition, both CK and the transgenic lines revealed no obvious difference after growing for 2 weeks in soil, while in soil containing 250 mmol·L−1 NaCl, survival rate of ST7-OE1 (~ 32%) and ST7-OE2 (~ 38%) seedlings was significantly higher than that of the CK seedlings (~ 20%) (Fig. 1C, D). These results indicated that ThST7 overexpression in cotton improved seed germination under salt stress.

ThST7 enhanced seedling growth under salt stress

To demonstrate the ThST7-conferred salt tolerance in seedlings, we conducted seedling growth and survival in hydroponic culture with 0 or 140 mmol·L−1 NaCl as described in “Methods” section. After 140 mmol·L−1 NaCl treatment for 3 days, the survival rate of transgenic seedlings (~ 70%∼78%) was significantly higher than that of CK (~ 20%), while in absence of NaCl stress, transgenic and CK seedlings survived almost equally (100%) (Fig. 2A, B). We also examined the salt tolerance of transgenic seedlings grown in soil. The 20-days-old seedlings were treated without or with 300 mmol·L−1 NaCl for 10 days (Fig. 2C). Under no salt control condition, no apparent difference was observed between the CK and the transgenic lines, while under salt stress condition the CK was more sensitive to the salt stress compared with the transgenic plants. The transgenic limes exhibited significantly higher survival rates (~ 76%∼78%) than the CK (~ 40%) (Fig. 2C, D).

Fig. 2
figure 2

ThST7 overexpression improved salt tolerance of 2-weeks-old cotton seedlings grown in hydroponic culture or in soil under different salt concentrations. A, B Seeds of the CK and ST7-OE lines germinated in soil for 4 days, transferred to hydroponic culture for 1 week and then treated with 140 mmol·L−1 NaCl for 3 days. Bar = 4 cm. Values are mean ± SD (7 plants per replicate, four replicates per treatment). Different letters denote significant differences (P < 0.05) from Duncan's multiple range tests. C The 20-days-old seedlings grown in soil were treated with either 0 or 300 mmol·L−1 NaCl for 10 days before the images were recorded. Bar = 4 cm. D Survival rate of the seedlings as in C. Values are mean ± SD (10 plants per replicate, five replicates per treatment). Different letters denote significant differences (P < 0.05) from Duncan's multiple range tests

Full size image

ThST7 enhanced the tolerance against oxidative stress

To detect the level of reactive oxygen species (ROS) under salt treatment in transgenic lines, we performed diaminobenzidine (DAB) and nitrotetrazolium blue chloride (NBT) staining of cotton leaf. DAB staining visualized the accumulation of H2O2 while the NBT staining depicted the presence of superoxide radicals. Under the normal condition, the DAB and NBT staining were similar between the CK and transgenic lines. However, under the salt treatment (0.6% NaCl), less DAB staining signals were observed in the transgenic leaves compared with the control (Fig. 3A). Similarly, the blue NBT staining signals were significantly more and darker in the CK leaf compared with that in ST7-OE1 and ST7-OE2 lines (Fig. 3B). These results demonstrated that the transgenic cotton plants had a better ability to scavenge H2O2 and superoxide radicals compared with the CK plants.

Fig. 3
figure 3

DAB and NBT staining. The leaves of control, ST7-OE1, and ST7-OE2 plants treated with either 0 or 140 mmol·L−1 NaCl for one day before DAB (A) or NBT staining (B). Bar = 1 cm

Full size image

ThST7 improved cotton yield in field

To detect the effect of ThST7 on cotton yield, we performed a field trial in saline soil as described in “Methods” section. Under normal condition, there was no significant difference in cotton yield per plot between the CK and transgenic lines, while under 0.4% NaCl stress, cotton yield of CK was lower than that of ST7-OE1 and ST7-OE2 lines (Fig. 4A). The average boll weight of CK and transgenic lines was almost similar in normal conditions, but under 0.4% NaCl stress, boll weight of transgenic lines (ST7-OE1 and ST7-OE2) was heavier than that of CK (Fig. 4B). These results indicated that the overexpression of ThST7 increased cotton yield under salt stress in the field conditions.

Fig. 4
figure 4

ThST7 overexpression improved cotton yield in saline field. A Yield per plot of wild type, ST7-OE1 and ST7-OE2 lines in normal soil conditions (0.1% NaCl) and saline soil with 0.4% NaCl. B Average boll weight of the CK and ST7-OE lines as in A

Full size image

The genes involved in ion homeostasis and antioxidation were enriched and upregulated in the transgenic line

To investigate the molecular mechanism by which ThST7 confers salt tolerance in cotton, we compared the transcriptomes between ThST7-OE and CK under both normal and salt stress. Based on the RNA-seq read counts, a total of 9 182 differentially expressed genes (DEGs) were observed under the salt-stress treatment versus 1 918 DEGs under normal condition. A total of 790 genes were upregulated and 1 128 were downregulated under normal conditions, while 4 608 were upregulated and 4 574 were downregulated under salt stress (Fig. 5A).

Fig. 5
figure 5

RNA-seq of the CK and ST7-OE seedlings under normal and salt stress conditions. A Number of upregulated and downregulated genes in CK and ST7-OE under normal and salt stress condition as revealed by RNA sequencing. B Venn diagrams of the common and specific genes unique and shared between the different pairwise comparisons

Full size image

Transcriptomic differences between CK and ThST7-OE were determined by performing pairwise comparisons (CK-N vs. ThST7-OE1-N, CK-N vs. CK-S, and CK-S vs. ThST7-OE1-S). Based on these pairwise comparisons we have categorized into three groups: total number of genes found in the CK-N versus ThST7-OE1 are 73 from which 53 overlapped with CK-N versus CK-S. The total number of genes found in CK-N versus CK-S were 7 573, out of which 2 707 overlapped with CK-S versus ThST7-OE1-S. The total number of genes found in CK-S versus ThST7-OE1-S were 1 346, and out of which 10 overlapped with CK-N versus ThST7-OE1. Only 5 genes were found overlapped in all of these groups (Fig. 5B).

The DEGs were grouped into several biological processes under normal (Gig. 6A) and salt treatment (Fig. 6B). Abiotic stress-related genes were significantly upregulated in the transgenic plants as compared with the CK under normal and salt stress conditions (Additional file 1: Tables S1 and S2). ThST7-OE plants exhibited a drastic upregulation of genes involved in salt-tolerance such as KEA2, KEA3, NHX2, NHD1, and AKT2 under salt stress conditions as shown by the heat map (Fig. 7). Moreover, the genes encoding antioxidant enzymes such as ascorbate peroxidase, catalase, peroxidase, and glutathione S-transferase were prominently upregulated in ThST7-OE (Fig. 7, Additional file 1: Table S2). These results demonstrated that ThST7 affected the transcription of an array of salt-responsive genes in cotton.

Fig. 6
figure 6

The Gene ontology (GO) grouped up-regulated genes in different biological processes. A The number of genes involved in the biological processes under normal conditions. B The number of genes involved in the biological processes under salt conditions

Full size image
Fig. 7
figure 7

Heatmap of genes upregulated by in ST7-OE plants under normal conditions. Genes involved in different biological processes in CK and ST7-OE plants under normal conditions (A) and salt stressed conditions (B) were shown. The results were presented as log(2) ratios. Only results with a P value < 0.05 and that have been confirmed in three independent experiments were included. A color code was used to visualize the data

Full size image

To find out whether there are homologues of ThST7 in cotton genome, we performed a Blast search using ThST7 protein sequence against cotton genome. The BLAST results showed that there are 23 genes homologous to ThST7 in the Gossypium hirsutum L. genome. Among the 23 genes, 21 genes belong to Stem-specific protein TSJT1 family while the remaining 2 genes are annotated as hypothetical protein ERO13 (Additional file 1: Table S3), suggesting that ThST7 proteins might be functionally conserved in cotton.

Discussion

In this study we evaluated the salt tolerance conferred by ThST7 from Thellungiella halophila and demonstrated the feasibility of this gene improving salt tolerance in cotton.

Cotton is most sensitive to saline stress at germination stage (Peng et al. 2018). A significant reduction in cotton germination was seen in cotton upon exposure to salt stress (Khorsandi and Anagholi 2009; Ma et al. 2011), even a complete inhibition under high salinity stress (Sattar et al. 2010). In our study we observed that the ThST7 transgenic lines displayed early and increased germination under salt stress compared with CK (Fig. 1A, B, C). Thus, ThST7 confers a desirable trait—salt tolerance germination in cotton.

Seedling stage is a significant phase in plant life cycle and vulnerable to environmental stresses including salt stress, which significantly decreases seedling survival (Sattar et al. 2010). Our results showed that upon exposure to salt stress ThST7-OE lines displayed significantly enhanced seedling growth and survival rate as compared with CK both in soil and hydroponic culture (Fig. 2). This demonstrates that ThST7 is capable of enhancing salt tolerance of cotton seedlings, which would greatly benefit cotton seedling establishment in saline soil.

ROS accumulation is induced in plants under salt stress (Choudhury et al. 2017; Luo et al. 2021). An augmented production of ROS (including OH−, H2O2, O2, and O2−) generates cellular oxidative stress that harms membranes and macromolecules in plants (Lin et al. 2020). In our study we observed that ThST7-OE cotton exhibited higher ability of ROS scavenging as evidenced by DAB and NBT staining (Fig. 3). These results signify that ThST7 enhances antioxidant capabilities and protects cotton plants from oxidative damage.

One major goal of crop genetic engineering is to increase crop yield (Bao et al. 2016). High salt content in soil significantly decreases reproductive and vegetative growth of cotton that cause poor fiber quality and low yield (Dong 2012). The yield of cotton decreases with the reduction in boll number and weight (Longenecker 1974). Under saline conditions, decrease in mature bolls takes place due to reduction of fruit bearing position, augmented flower and boll shedding along with delayed flowering (Bernstein and Hayward 1958). Increase in the salt content of soil leads to decrease in the movement of sucrose towards developing bolls thus causing reduction in boll weight (Peng et al. 2016). In our study we demonstrated that in field trails the ThST7-OE lines produced higher yield and average boll weight than CK (Fig. 4) under salinity.

We also carried out RNA transcriptomic analysis of ThST7-OE lines under salt stress. It was revealed that transcript levels of various genes involved in tolerance against salinity stress were upregulated including NHX2, KEA2, KEA3, NHD1, and AKT2 (Fig. 7, Additional file 1: Table S2). Under salinity stress, plants adapt many strategies to main ion homeostasis via reduction in concentration of Na+ and increase in concentration of K+ (Cui et al. 2020). The accumulation of Na+ in vacuole by sodium/hydrogen exchangers (NHXs) aids in the maintenance of cellular Na+ homeostasis (Zhang et al. 2016a, b). The Na+ compartmentalization is controlled by Na+/H+ antiporter (NHX) (Apse and Blumwald 2007; Guo et al. 2020). It has been demonstrated that under salinity stress, NHX participates in the Na+ partition into vacuoles, which aids the cells to uptake water and sustain the osmotic balance, decreases the noxious effect of salt ions and regulates the cytoplasmic Na+ concentration and pH (Apse et al. 1999; Yamaguchi et al. 2001; Guo et al. 2020). In our study we observed that the transcript level of NHX2 is upregulated in transgenic OE lines of cotton compared with that in CK. The function of NHX2 is linked to accumulation of Na+ in vacuole and thus leading to salt tolerance in saline environment (Yarra and Kirti 2019).

Along with this, we also observed the transcript levels of KEA2 and KEA3 were upregulated under salt stress in transgenic cotton lines as compared with CK. KEAs are potassium efflux antiporters. KEA2 works as a mediator for monovalent cation/proton exchange and is localized in chloroplast inner envelop membrane (Aranda-Sicilia et al. 2012). However, potassium transporter KEA3 is highly expressed to transport Na+ and Cl− into the vacuole for ion absorption and balance adjustments under salt stress (Zhang et al. 2020). It was shown that under osmotic stress KEA2 and KEA3 were involved in hyperosmotic-induced Ca2+ responses. It was demonstrated that KEA2 and KEA3 mutants displayed reduced Ca2+ levels during the hyperosmotic-induced Ca2+ response, thus depicting that KEA2 and KEA3 act as sensors of osmotic stress that are able to regulate the enhancement of Ca2+ (Stephan et al. 2016).

We also observed that the transcript level of AKT2 was also upregulated under salt stress in transgenic cotton lines. AKT2 (Arabidopsis K+ transporter) is a K+ channel that is permeable to K+ but not Na+ and is located in leaf phloem tissue (Tian et al. 2021). The maintenance of Na+/K+ homeostasis is important for the survival of plants under salt stress, which is dependent upon the function of Na+ and K+ transporters (Assaha et al. 2017). The AKT2 knockout rice plants were more sensitive to saline environment compared with the wild types (Tian et al. 2021). In another study it was demonstrated that under salt stress the upregulation of AKT2 led to augmented K+ in vascular bundles along with its redistribution between roots and shoots of Arabidopsis (Pilot et al. 2003).

Conclusions

In conclusion, ThST7 improves cotton seed germination and growth under salt stress. The transgenic cotton lines exhibits increased yield in saline soil in field trial. The salt tolerance phenotype of ThST7-OE plants is supported by the transcriptomic analyses results. Therefore, ThST7 is a candidate gene for salt tolerance improvement in cotton.

Methods

ThST7 gene cloning and plant transformation

Full length complimentary ThST7 gene was successfully cloned into a plant binary expression vector (pCB2004) under the control of constitutive promoter CaMV (cauliflower mosaic virus) 35S. ThST7 gene was followed by Nos terminator (Additional file 1: Fig. S1A). NPTII (neomycin phosphotransferase) gene of the vector was used as a selection marker both in the initial screening of transformant bacterial colonies and cotton plants. Transgenic cotton lines were obtained by Agrobacterium–mediated transformation (Li et al. 2002) of vector construct into callus segment of explant. The regenerated pallets after transformation were transferred to soil to get T0 seeds. T1 seed were harvested by grafting the T0 shots in wild type plants. T3 generation of transformed cotton along with wildtype (CK) was used to carry out this study.

RNA isolation and RT-PCR

Fresh leaves were taken from plants of both genotypes and ground in mortar and pestle with the use of liquid nitrogen. Total RNA was isolated using Eastep Super Total RNA Extraction Kit (Promega Biotech Co. Ltd., Beijing). Isolated RNA (1 μg) from each sample was subjected for reverse transcription reaction. The cDNA was used for RT-PCR analysis to check the expression level of transgenic lines with primers ST7-F (ATGTTGGGAATTTTCAGCGGAG) and ST7-R (TCAATCTGCAAGAACTGCTGCT). GhHis3 (AF024716) was used as internal control (Forward: TGGGAAGGCTCCAAGGAAGCA, Reverse: CGAGCCAACTGGATGTCCTTG) (Additional file 1: Fig. S1B).

Plant materials

Cotton (Gossypium hirsutum L.) cultivar R15 was used in this study. Experiments were conducted in the green house facility of School of Life Sciences, University of Science and Technology of China, Hefei, China.

Seed germination

Transgenic cotton lines along with CK seeds were germinated in long day/night (16/8 h) conditions with temperature 2526 °C. For germination under salt tolerance, seeds were germinated under irrigation with 0 or 250 mmol·L−1 of NaCl for 8 days. Germination rate was observed for each day after sowing.

Survival rates

Transgenic cotton lines were grown for 4 days in normal growth conditions in soil (16/8 h of light and 28°C). On the fifth day of germination, seedlings were transferred to hydroponic solution (Hoagland and Arnon 1950) for 1 week and treated with 140 mmol·L−1 NaCl for another 3 days in the green house under controlled conditions and survival rate was counted. Likewise, transgenic and CK lines were grown in soil for 20 days and treated with 0 or 300 mmol·L−1 NaCl for another 10 days before survival rate was counted.

DAB and NBT protocol

To analyze the ROS scavenging capacity of the transgenic lines, DAB and NBT staining were conducted as described (Alvarez et al. 1998). Briefly, the leaves from the ST7-OE1 and ST7-OE2 transgenic lines and CK plants were treated with 0 or 0.6% NaCl, then stained in the 0.1% (w/v) DAB solution in the dark for 18 h. Afterwards, leaves were submerged in 96% (v/v) ethanol to remove chlorophyll. For NBT staining, the leaves were stained in NBT staining solution for 12 h, then treated with 96% (v/v) ethanol to remove chlorophyll.

Field trial of cotton

To check the performance of ThST7 transgenic cotton, field trials were performed in Experiment Station of Shanxi Agricultural Academy, Yuncheng, Shanxi Province, China from April 2020 to September 2020. Experimental design contained 3 replicate plots per genotype per treatment with plot size of 2.5 X 6 m2 with random arrangement. During the whole growth period, the control group was grown in the soil with salt (NaCl) content < 0.1%, while the salt stress treatment group was grown in the soil with 0.4% NaCl. Cotton yield (fiber plus seeds) was recorded at the end of the field trial.

RNA sequencing

The plants were grown hydroponically with the conditions described above as CK and salt treated lines (140 mmol·L−1 NaCl). The 16-days-old seedlings were sampled for RNA sequencing. A total of 20 seedlings of the salt treated, and controls were collected. RNA library construction and sequence analysis were conducted as described (Hu et al. 2016).

Accession numbers

Sequence data from this article can be found in the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/) or Arabidopsis TAIR database (https://www.arabidopsis.org/) under the following accession numbers: AtNHX7: NM_126259, ThST7-5–2: EU714069, EU714068, ST225: EU714080, GhHIS3: LOC107951735, AT5G19140: AK318630, AtNHX1: AT5G27150.

Availability of data and materials

All data generated or analyzed during this study are included in this published article [and its supplementary information files].

References

  1. Agarwal G, Rajavel M, Gopal B, et al. Structure-based phylogeny as a diagnostic for functional characterization of proteins with a cupin fold. PLoS ONE. 2009;4(5):e5736. https://doi.org/10.1371/journal.pone.0005736.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  2. Alvarez ME, Pennell RI, Meijer P-J, et al. Reactive oxygen intermediates mediate a systemic signal network in the establishment of plant immunity. Cell. 1998;92(6):773–84. https://doi.org/10.1016/S0092-8674(00)81405-1.

    CAS  Article  PubMed  Google Scholar 

  3. Apse MP, Blumwald E. Na+ transport in plants. FEBS Lett. 2007;581(12):2247–54. https://doi.org/10.1016/j.febslet.2007.04.014.

    CAS  Article  PubMed  Google Scholar 

  4. Apse MP, Aharon GS, Snedden WA, et al. Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science. 1999;285(5431):1256–8. https://doi.org/10.1126/science.285.5431.1256.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  5. Aranda-Sicilia MN, Cagnac O, Chanroj S, et al. Arabidopsis KEA2, a homolog of bacterial KefC, encodes a K+/H+ antiporter with a chloroplast transit peptide. Biochim Biophys Acta (BBA) Biomembr. 2012;1818(9):2362–71. https://doi.org/10.1016/j.bbamem.2012.04.011.

    CAS  Article  Google Scholar 

  6. Assaha DV, Ueda A, Saneoka H, et al. The role of Na+ and K+ transporters in salt stress adaptation in glycophytes. Front Physiol. 2017;8:509. https://doi.org/10.3389/fphys.2017.00509.

    Article  PubMed  PubMed Central  Google Scholar 

  7. Bao AK, Du BQ, Touil L, et al. Co-expression of tonoplast Cation/H+ antiporter and H+-pyrophosphatase from xerophyte Zygophyllum xanthoxylum improves alfalfa plant growth under salinity, drought and field conditions. Plant Biotechnol J. 2016;14(3):964–75. https://doi.org/10.1111/pbi.12451.

    CAS  Article  PubMed  Google Scholar 

  8. Bernstein L, Hayward H. Physiology of salt tolerance. Annu Rev Plant Physiol. 1958;9(1):25–46. https://doi.org/10.1146/annurev.pp.09.060158.000325.

    CAS  Article  Google Scholar 

  9. Blumwald E. Sodium transport and salt tolerance in plants. Curr Opin Cell Biol. 2000;12(4):431–4. https://doi.org/10.1016/S0955-0674(00)00112-5.

    CAS  Article  PubMed  Google Scholar 

  10. Cheng C, Zhang Y, Chen X, et al. Co-expression of AtNHX1 and TsVP improves the salt tolerance of transgenic cotton and increases seed cotton yield in a saline field. Mol Breed. 2018;38(2):19. https://doi.org/10.1007/s11032-018-0774-5.

    CAS  Article  Google Scholar 

  11. Choudhury FK, Rivero RM, Blumwald E, et al. Reactive oxygen species, abiotic stress and stress combination. Plant J. 2017;90(5):856–67. https://doi.org/10.1111/tpj.13299.

    CAS  Article  PubMed  Google Scholar 

  12. Cui J, Hua Y, Zhou T, et al. Global landscapes of the Na+/H+ antiporter (NHX) family members uncover their potential roles in regulating the rapeseed resistance to salt stress. Int J Mol Sci. 2020;21(10):3429. https://doi.org/10.3390/ijms21103429.

    CAS  Article  PubMed Central  Google Scholar 

  13. Darko E, Khalil R, Dobi Z, et al. Addition of Aegilops biuncialis chromosomes 2M or 3M improves the salt tolerance of wheat in different way. Sci Rep. 2020;10(1):1–13. https://doi.org/10.1038/s41598-020-79372-1.

    CAS  Article  Google Scholar 

  14. Dong H. Combating salinity stress effects on cotton with agronomic practices. Afr J Agric Res. 2012;7(34):4708–15. https://doi.org/10.5897/AJAR12.501.

    Article  Google Scholar 

  15. Du J, Huang YP, Xi J, et al. Functional gene-mining for salt-tolerance genes with the power of Arabidopsis. Plant J. 2008;56(4):653–64. https://doi.org/10.1111/j.1365-313X.2008.03602.x.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  16. Flowers TJ, Colmer TD. Salinity tolerance in halophytes. New Phytol. 2008;179(4):945–63. https://doi.org/10.1111/j.1469-8137.2008.02531.x.

    CAS  Article  PubMed  Google Scholar 

  17. Guo Q, Tian XX, Mao PC, Meng L. Overexpression of Iris lactea tonoplast Na+/H+ antiporter gene IlNHX confers improved salt tolerance in tobacco. Biol Plant. 2020;64:50–7. https://doi.org/10.32615/bp.2019.126.

    CAS  Article  Google Scholar 

  18. Hoagland DR, Arnon DI. The water-culture method for growing plants without soil. Circular. California Agricultural Experiment Station, 2nd ed. 1950. p. 347. https://www.cabdirect.org/cabdirect/abstract/19500302257.

  19. Hu Y, Xue YQ, Liu JS, et al. Hybrid lethality caused by two complementary dominant genes in cabbage (Brassica oleracea L.). Mol Breed. 2016;36(6):1–10. https://doi.org/10.1007/s11032-016-0498-3.

    CAS  Article  Google Scholar 

  20. Khorsandi F, Anagholi A. Reproductive compensation of cotton after salt stress relief at different growth stages. J Agron Crop Sci. 2009;195(4):278–83. https://doi.org/10.1111/j.1439-037X.2009.00370.x.

    Article  Google Scholar 

  21. Li XB, Cai L, Cheng NH, et al. Molecular characterization of the cotton GhTUB1 gene that is preferentially expressed in fiber. Plant Physiol. 2002;130(2):666–74. https://doi.org/10.1104/pp.005538.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  22. Lin IS, Wu YS, Chen CT, et al. AtRBOH I confers submergence tolerance and is involved in auxin-mediated signaling pathways under hypoxic stress. Plant Growth Regul. 2017;83(2):277–85. https://doi.org/10.1007/s10725-017-0292-1.

    CAS  Article  Google Scholar 

  23. Lin YJ, Yu XZ, Li YH, et al. Inhibition of the mitochondrial respiratory components (Complex I and Complex III) as stimuli to induce oxidative damage in Oryza sativa L. under thiocyanate exposure. Chemosphere. 2020;243:125472. https://doi.org/10.1016/j.chemosphere.2019.125472.

    CAS  Article  PubMed  Google Scholar 

  24. Longenecker D. The influence of high sodium in soils upon fruiting and shedding, boll characteristics, fiber properties, and yields of two cotton species. Soil Sci. 1974;118(6):387–96.

    CAS  Article  Google Scholar 

  25. Luo X, Dai Y, Zheng C, et al. The ABI4-RbohD/VTC2 regulatory module promotes reactive oxygen species (ROS) accumulation to decrease seed germination under salinity stress. New Phytol. 2021;229(2):950–62. https://doi.org/10.1111/nph.16921.

    CAS  Article  PubMed  Google Scholar 

  26. Lv S, Zhang K, Gao Q, et al. Overexpression of an H+-PPase gene from Thellungiella halophila in cotton enhances salt tolerance and improves growth and photosynthetic performance. Plant Cell Physiol. 2008;49(8):1150–64. https://doi.org/10.1093/pcp/pcn090.

    CAS  Article  PubMed  Google Scholar 

  27. Ma X, Dong H, Li W. Genetic improvement of cotton tolerance to salinity stress. Afr J Agric Res. 2011;6(33):6797–803.

    Google Scholar 

  28. Ma W, Ren Z, Zhou Y, et al. Genome-wide identification of the Gossypium hirsutum NHX genes reveals that the endosomal-type GhNHX4A is critical for the salt tolerance of cotton. Int J Mol Sci. 2020;21(20):7712. https://doi.org/10.3390/ijms21207712.

    CAS  Article  PubMed Central  Google Scholar 

  29. Martinez G, Abdelraheem A, Darapuneni M, et al. Evaluation of a multi-parent advanced generation inter-cross (MAGIC) introgressed line population for Verticillium wilt resistance in Upland cotton. Euphytica. 2018;214(10):197. https://doi.org/10.1007/s10681-018-2278-0.

    CAS  Article  Google Scholar 

  30. Martinoia E, Maeshima M, Neuhaus HE. Vacuolar transporters and their essential role in plant metabolism. J Exp Bot. 2007;58(1):83–102. https://doi.org/10.1093/jxb/erl183.

    CAS  Article  PubMed  Google Scholar 

  31. Munns R, Tester M. Mechanisms of salinity tolerance. Annu Rev Plant Biol. 2008;59:651–81. https://doi.org/10.1146/annurev.arplant.59.032607.092911.

    CAS  Article  PubMed  Google Scholar 

  32. Pál M, Majláth I, Németh E, et al. The effects of putrescine are partly overlapping with osmotic stress processes in wheat. Plant Sci. 2018;268(3):67–76. https://doi.org/10.1016/j.plantsci.2017.12.011.

    CAS  Article  PubMed  Google Scholar 

  33. Parida AK, Das A, Mittra B. Effects of salt on growth, ion accumulation, photosynthesis and leaf anatomy of the mangrove, Bruguiera parviflora. Trees. 2004;18(2):167–74. https://doi.org/10.1007/s00468-003-0293-8.

    CAS  Article  Google Scholar 

  34. Pasapula V, Shen G, Kuppu S, et al. Expression of an Arabidopsis vacuolar H+-pyrophosphatase gene (AVP1) in cotton improves drought- and salt tolerance and increases fibre yield in the field conditions. Plant Biotechnol J. 2011;9(1):88–99. https://doi.org/10.1111/j.1467-7652.2010.00535.x.

    CAS  Article  PubMed  Google Scholar 

  35. Peng J, Liu J, Zhang L, et al. Effects of soil salinity on sucrose metabolism in cotton leaves. PLoS ONE. 2016;11(5):e0156241. https://doi.org/10.1371/journal.pone.0156241.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  36. Peng Z, He S, Gong W, et al. Integration of proteomic and transcriptomic profiles reveals multiple levels of genetic regulation of salt tolerance in cotton. BMC Plant Biol. 2018;18(1):1–19. https://doi.org/10.1186/s12870-018-1350-1.

    CAS  Article  Google Scholar 

  37. Pilot G, Gaymard F, Mouline K, et al. Regulated expression of Arabidopsis Shaker K+ channel genes involved in K+ uptake and distribution in the plant. Plant Mol Biol. 2003;51(5):773–87. https://doi.org/10.1023/A:1022597102282.

    CAS  Article  PubMed  Google Scholar 

  38. Sattar S, Hussnain T, Javaid A. Effect of NaCl salinity on cotton (Gossypium arboreum L.) grown on MS medium and in hydroponic cultures. J Anim Plant Sci. 2010;20:87–9.

    Google Scholar 

  39. Stephan AB, Kunz HH, Yang E, et al. Rapid hyperosmotic-induced Ca2+ responses in Arabidopsis thaliana exhibit sensory potentiation and involvement of plastidial KEA transporters. Proc Natl Acad Sci. 2016;113(35):E5242–9. https://doi.org/10.1073/pnas.1519555113.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  40. Tester M, Davenport R. Na+ tolerance and Na+ transport in higher plants. Ann Bot. 2003;91(5):503–27. https://doi.org/10.1093/aob/mcg058.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  41. Tian Q, Shen L, Luan J, et al. Rice Shaker potassium channel OsAKT2 positively regulates salt tolerance and grain yield by mediating K+ redistribution. Plant Cell Environ. 2021;44:2951–65. https://doi.org/10.1111/pce.14101.

    CAS  Article  PubMed  Google Scholar 

  42. Wang W, Vinocur B, Altman A. Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta. 2003;218(1):1–14. https://doi.org/10.1007/s00425-003-1105-5.

    CAS  Article  PubMed  Google Scholar 

  43. Yamaguchi T, Fukada-Tanaka S, Inagaki Y, et al. Genes encoding the vacuolar Na+/H+ exchanger and flower coloration. Plant Cell Physiol. 2001;42(5):451–61. https://doi.org/10.1093/pcp/pce080.

    CAS  Article  PubMed  Google Scholar 

  44. Yarra R, Kirti P. Expressing class I wheat NHX (TaNHX2) gene in eggplant (Solanum melongena L.) improves plant performance under saline condition. Funct Integr Genomics. 2019;19(4):541–54. https://doi.org/10.1007/s10142-019-00656-5.

    CAS  Article  PubMed  Google Scholar 

  45. Zhang F, Zhu G, Du L, et al. Genetic regulation of salt stress tolerance revealed by RNA-Seq in cotton diploid wild species, Gossypium davidsonii. Sci Rep. 2016a;6(1):1–15. https://doi.org/10.1038/srep20582.

    CAS  Article  Google Scholar 

  46. Zhang K, Song J, Chen X, et al. Expression of the Thellungiella halophila vacuolar H+-pyrophosphatase gene (TsVP) in cotton improves salinity tolerance and increases seed cotton yield in a saline field. Euphytica. 2016b;211(2):231–44. https://doi.org/10.1007/s10681-016-1733-z.

    CAS  Article  Google Scholar 

  47. Zhang X, Yao Y, Li X, et al. Transcriptomic analysis identifies novel genes and pathways for salt stress responses in Suaeda salsa leaves. Sci Rep. 2020;10(1):1–12.

    Article  Google Scholar 

  48. Zhu JK. Salt and drought stress signal transduction in plants. Annu Rev Plant Biol. 2002;53(1):247–73. https://doi.org/10.1146/annurev.arplant.53.091401.143329.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

This work was supported by grants from Ministry of Science and Technology of China (Grant No. 2016ZX08005004-003).

Funding

Ministry of Science and Technology of China (Grant No. 2016ZX08005004-003).

Author information

Affiliations

  1. Division of Molecular & Cell Biophysics, School of Life Sciences, Hefei National Science Center for Physical Sciences at the Microscale, University of Science and Technology of China, The Innovative Academy of Seed Design, Chinese Academy of Sciences, Hefei, Anhui, China

    ALI Mohsin, NAZISH Tahmina, JAVAID Ayesha, WU Jie, XIANG Chengbin & ALFATIH Alamin

  2. Institute of Cotton Research, Shanxi Agricultural University, Yuncheng, 044000, China

    ZHU Yonghong, LI Jing & ZHANG Huangyang

  3. College of Life Sciences, Shanxi Agricultural University, Taiyuan, 030031, China

    WU Shenjie

Authors
  1. ALI Mohsin
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. NAZISH Tahmina
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. JAVAID Ayesha
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. ZHU Yonghong
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. LI Jing
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. ZHANG Huangyang
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. WU Jie
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. XIANG Chengbin
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. WU Shenjie
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. ALFATIH Alamin
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Alfatih A, Xiang CB and Wu SJ designed the experiments. Ali M, Nazish T, Javaid A, Wu J performed most of the experiments and data analyses. Zhu YH, Li J, Zhang HY, and Wu SJ conducted field trials and data analyses. Ali M and Alfatih A wrote the manuscript. Alfatih A, Wu SJ and Xiang CB revised the manuscript and supervised the project. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to WU Shenjie or ALFATIH Alamin.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

The manuscript has not been published or submitted for publication elsewhere.

Competing interests

The authors declare no competing interests.

Supplementary Information

Additional file 1: Fig. S1.

Overexpression construct of ThST7 and verification of the transgenic lines. Table S1. Abiotic stress-related genes that are significantly upregulated in the transgenic line compared to wild type control under normal condition. Table S2. Abiotic stress-related genes that are significantly upregulated in the transgenic line compared to wild type control under salt stress condition. Table S3. ThST7 homologues in cotton genome.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

ALI, M., NAZISH, T., JAVAID, A. et al. Evaluation of Thellungiella halophila ST7 for improving salt tolerance in cotton. J Cotton Res 5, 1 (2022). https://doi.org/10.1186/s42397-021-00108-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s42397-021-00108-1

Keywords

  • Gossypium hirsutum
  • Aluminum-induced protein
  • Salinity
  • Thellungiella halophila
  • ST7
  • Salt tolerance

Journal of Cotton Research

ISSN: 2523-3254

Contact us